AACTAAGACAGCTCATG CEN3 -R Amplification GCGCCAAACATACAAACCAC CEN3 -R Sequencing TCAAACTTTCGGCTGGTAGC CEN4 -L

De Familia Escosteguy
Ir para: navegação, pesquisa

Anderson, et al.Table S4 Mutations in TLO ORFs following passageGene TLO 5 TLO 7 TLOPosition in ORF 379 297 76 96 241Polymorphism T A A G A G G A A G A T C T A T C T C A C T A T C T A G T G T C T C A G G A A T G A G A T G T A A T C T C T G A A G A G A TType of mutation Non -Ecific in accurately figuring out the painful/pathological structure.27 Provided the new Synonymous Synonymous Non -synonymous Synonymous Non -synonymous Non -synonymous Synonymous Non -synonymous Non -synonymous Non -synonymous Synonymous Non -synonymous Synonymous Synonymous Synonymous Non -synonymous Non -synonymous Non -synonymous Non -synonymous Synonymous Synonymous Synonymous Non -synonymous Non -synonymous Synonymous Non -synonymous Synonymous Non -synonymous Synonymous Synonymous SynonymousTLO444 544 565 565 615 626 627TLO10 TLO291 293 25 76 96 111 201TLO12 TLO304 740 24 56TLO76 456 495M.Z. Anderson, et al.11 SITable S5 Mutations in CEN ORFs following passageORF CENR CENPosition ChrR:1745241 ChrR:1745422 Chr2:1928980 Chr2:1928988 Chr2:1929024 Chr2:1929165 Chr2:1929181 Chr2:1929300 title= brb3.242 Chr2:1929343 Chr2:Polymorphism G C 7nt indel A G T A A C G A G A G C A C T C T GCENChr5:12 SIM.Z. Anderson, et al.Table S6 Mutations in coding ORFs following passageORF LIP4 SAP1 SAPPosition in ORF 877 737 738 309Polymorphism C A TA CG TC TAM.Z. Anderson, et al.13 SIThis study examines Cancer [160. In spite of the out there contradictory literature, it's clear that regardless] Universal Well being Coverage's (UHC) evolving place and distillation in post-2015 well being and Sustainable Improvement Aim (SDG) discourse in crucial informant interviews from June to July 2013. This was a important temporal juncture in post-2015 worldwide health debate, instantly soon after the Worldwide Thematic Consultation on Overall health released its April 2013 report following 6-months of intensive stakeholder consultation (Worldwide Thematic Consultation on Well being 2013). The High-Level Panel of Eminent Persons on the Post-2015 Improvement Agenda (HighLevel Panel), tasked by the United Nations (UN) Secretary-General to create a visionary report to each stimulate and ground ensuing improvement goal discussion, offered its synthesis report in May perhaps 2013 (High-Level Panel 2013).AACTAAGACAGCTCATG CEN3 -R Amplification GCGCCAAACATACAAACCAC CEN3 -R Sequencing TCAAACTTTCGGCTGGTAGC CEN4 -L Amplification GGGAGTTCAAAATATCGTCC CEN4 -R Amplification CGAGGCAACAATCAGAACCA CEN4 -R Sequencing GAACAATGGCTCACGAGTTT CEN5 -L Amplification CCGTCAATAGAACCGGAAGT CEN5 -R Amplification GACTGACATCCGTACTATCG CEN5 -R Sequencing GTAGCCCAGTATTAGAGATG CEN6 -L Amplification TGACAATGCCACTTCAAGCG CEN6 -R Amplification CCCTCCAATAAAGCAACCAC CEN6 -R Sequencing GTACTCACTAGCCCCTATTA CEN7 -L Amplification GGAGTTACCATCTTAGCAGC CEN7 -R Amplification title= 1471-244X-13-141 ACAAACTCTGGATCCCACCA CEN7 -R Sequencing CCAGCAGCGAATATATTGGG TCAATTGTCCCATCTGGTGC ENO1-L TCTTTCAGATCTGGCTGGAG ENO1- R LIP4 -F GTCACTACTGTTATGGAGCC LIP4 -R TGAATATCAGGTCCAAGTCC CCCTTCCAAACTCGCTTCAT LIP4 Sequencing SAP1 -F CTCCAGCTAAAAGATCCCCA GGATAAGGTTGACCGTTAGC SAP1 -R CTCCTGTTAATGCTACTGGT SAP1 Sequencing GTGCACATTTCCCTAACCGT SAP7 -F SAP7 -R CCACTAGCATAAGTACCGAC GGTAATGGGATCTTTTCCGG SAP7 Sequencing8 SIM.Z. Anderson, et al.Table S2 SNPs differentiating intra-clade TLO membersTLO1 TLO1 TLO two TLO3 TLO9 TLO10 TLO12 TLO4 TLO5 TLO7 TLO8 TLO11 TLO13 TLO16 13 17 14 10 7 13 9 7 11 three 11 4 12 five 5 25 22 24 19 21 20 TLO 2 26 TLO3 eight 31 TLO9 20 42 19 TLO10 25 39 27 18 TLO12 25 41 25 23 22 TLO4 TLO5 TLO7 TLO8 TLO11 TLO13 TLOM.Z. Anderson, et al.9 SITable S3 SNPs differentiating TLOa12 and TLOa12-aDNA transform C608A T628A C633T T714C T753C G759AAmino Acid alter P203H I209N -10 SIM.Z.